Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
NFATC3 | |||
Gene | NFATC3 | Organism | Human |
Genome Locus | chr16:68121987-68126610:n/a | Build | hg19 |
Disease | Epithelial Ovarian carcinoma | ICD-10 | Other and unspecified female genital organs (D07.3) |
DBLink | Link to database | PMID | 27119352 |
Experimental Method | |||
Sample Type | Ovarian cancer cells OVCAR3 and SKOV3 and tissue samples from the ovary, peritoneum and lymph node | Comparison | Tissue samples from the ovary, peritoneum and lymph node of the diseased and normal people |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGGGGGACATCCTGTTGTGA ReverseTTGGAGCTGAAACGATGGTGA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Ahmed, I, Karedath, T, Andrews, SS, Al-Azwani, IK, Mohamoud, YA, Querleu, D, Rafii, A, Malek, JA (2016). Altered expression pattern of circular RNAs in primary and metastatic sites of epithelial ovarian carcinoma. Oncotarget, 7, 24:36366-36381. |